Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11390E10
Clone ID IST11390E10
Vector VICTR76
Project tigm

Sequence tag IST11390E10HMF1
Sequence
CAATGACTCATCTTTGTCACAGAAGATGACTTTAATACATGAGAAAATTTAACTCTAAAGACACCTGCTCTAGAGTTACT
GGTAGACAGATAATTAAAGCTTAAGGTANTTGANACAAGGATAAATAATATTTATTAAGTAAAATTACATTTATGTGTGC
CCTTCCCCCAGCCTTGANTAGGCTAAACAACCCCACCCCTCATGGTTTTTACAACCTGGCCTTGCTGCATTTGCAATTCC
CTACTGTGCTNTGANAAGTTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 11726879..11727138 250
NO GENE  


Sequence tag IST11390E10HMR1
Sequence
NTGTCTCTTGCNNAGGAGGAGGTAACACCAGAGTGCCTTTCTCTGCAGGCTCCAGTGATTGGGTTTTGCCAGGAGACTGA
TTTGTCCCACCTTATCCATGGTCTCCTGTGGAAGGGCAGGTATCAGTGTGTTTCAAGAAGCTTATATGTTTCTGTCTTAA
AGTCTGATCCTTCGCCAGTTTCCAGGACTGCCCATGTTTACGGATGACTTACTAAGCTCTTGGTCATTTAAAGAGAACAG
GTGATATTTTACCTCCTGAAAGACAACAAGGGTTCCTTTGTGCTCCCTTTTACNTGACNCANANGGTANGTATGACCTTG
ANAAANGANATN
Sequence Type genomic DNA
Unitrap ID UNI30806

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 11727137..11727466 310
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023826 (Park2) NP_057903 Parkinson disease (autosomal recessive, juvenile) 2, parkin Gene [Source:MGI Symbol;Acc:MGI:1355296]

 
Come back to gene ENSMUSG00000023826


For any suggestions or comments, please send an email to unitrap@crg.es