Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10408G12
Clone ID IST10408G12
Vector VICTR76
Project tigm

Sequence tag IST10408G12HMR1
Sequence
AGAGGAGAAACCCTGTTGGAGTCAGTTCTCGCCCTCCACCTTGTAGGTTCTGAGGACCAAACTCAGGTGTTCAGGTTTGG
T
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104174606..104174686 81
NO GENE  


Sequence tag IST10408G12BBF1
Sequence
CTCTGATGACCTTCACACCGTGTCACAAGCATACACCCACATCCGCACAAATGAATTAATGTAATTTAATTTTTTTAAAA
AAGGTACTGAAGACTACAGACCCCTCTGGAGTGGTGTTTACCTTGAAGAAATGGACTGCAGGGGACTCTGCANACATTGA
GTGTCCTGAGGTTCATTTANATTTTCCATCAAGCTAAGCAAGAGTGACACATGTTATCCTANCAACCTCAGGTTGGACCA
AGGAGTCTGTTTAGCCTGGACTCCACATGAAGGAAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI30920

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104174683..104174962 274
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018411 (Mapt) NM_001038609 microtubule-associated protein tau Gene [Source:MGI (curated);Acc:Mapt-003]

 
Come back to gene ENSMUSG00000018411


For any suggestions or comments, please send an email to unitrap@crg.es