Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15096F10
Clone ID IST15096F10
Vector VICTR80
Project tigm

Sequence tag IST15096F10HMF1
Sequence
CCATCATCATGAGATATGCTTTTAAATCTAGGTCTAGGTTCTCAGGTGTGTTGGGGTCCCCTGGACTGGGCGAAGTGGGT
GTGCTGGGTTCTGGTGATGGTGAGTGGTCTTGGTTCCTGTTAGTAAGATTCCTCCGTTTACCTTTCGCCATCTGGTAATC
TCTGGAGTTAGTAGTTATAGTTA
Sequence Type genomic DNA
Unitrap ID UNI28018 UNI33670 UNI33671

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 35979993..35980174 182
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055453 (A830019P07Rik) RIKEN cDNA A830019P07 gene Gene [Source:MGI Symbol;Acc:MGI:3028035]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 59275866..59276047 182
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 35443102..35443283 182
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022844 (Pdia5) NM_028295 protein disulfide isomerase associated 5 Gene [Source:MGI Symbol;Acc:MGI:1919849]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 65890171..65890352 182
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 59208378..59208559 182
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000055254 (Ntrk2) NM_008745 neurotrophic tyrosine kinase, receptor, type 2 Gene [Source:MGI Symbol;Acc:MGI:97384]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 14003738..14003919 182
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 16286633..16286814 182
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 16370602..16370783 182
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 78938454..78938635 182
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 64049326..64049507 182
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 71740493..71740674 182
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 52240124..52240305 182
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 69930072..69930253 182
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 46983893..46984074 182
NO GENE  


Sequence tag IST15096F10HMR1
Sequence
CANTCAGTAGTACTTACTTCNANATGCCCCTAANTGAGACACCAAGACACANATTGATGCNNNNNCNNNAGGTTTATTTT
CTGGTGAGTTGGAGTCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000055254


For any suggestions or comments, please send an email to unitrap@crg.es