Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11182B9
Clone ID IST11182B9
Vector VICTR76
Project tigm

Sequence tag IST11182B9BBF1
Sequence
TGATCACAGGTTCTGCTTCTTCCACCCACGGCTCTGCTTCTAAAGGGAGATCCACCAGCCGCTGTGCTTCGGCCTGGCCA
AGAGATTGACCTTCGAGCGCGCCAGGAAGTTCCTGGGTCTCAACCATTGCCAGCAGTTTCTAAACATGGGCATGGGGCTG
CCGAGTGGCACGCTGGATTTCTTCCTCANCGTAAACATCCCTATCATGGAGTTGTACNGCTTGTCNGAGTGCACGGNACT
ACACACAGTGTCCAACCTGCNNGCTNACCGGATACTGANGTGGGTGTGGATGGNCCTCTGTCTTCCCTCANGACAGCAGC
CCAATCCGGGGATCN
Sequence Type genomic DNA
Unitrap ID UNI30821

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 57023005..57023338 314
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024209 (1700061G19Rik) NM_030141 RIKEN cDNA 1700061G19 gene Gene [Source:MGI Symbol;Acc:MGI:1925875]


Sequence tag IST11182B9HMF1
Sequence
TGATCACAGGTTCTGCTTCTTCCANCCACGGCTCTGCTTCTAAAGGGAGATCCACCAGCCGCTGTGCTTCGGCCTGGA
Sequence Type genomic DNA
Unitrap ID UNI30850

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 57023005..57023081 75
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024209 (1700061G19Rik) NM_030141 RIKEN cDNA 1700061G19 gene Gene [Source:MGI Symbol;Acc:MGI:1925875]

 
Come back to gene ENSMUSG00000024209


For any suggestions or comments, please send an email to unitrap@crg.es