Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AG0493
Clone ID AG0493
Vector pGT0lxr
Project sanger

Sequence tag AG0493
Sequence
TCTATTTGTCTCGGAATCTTCCTAGTTCTCCATTCTATCTCTTTCTTCTCTGTTATCTATGAGGTTCGTATCATTCTATC
TTTGCTTTGGGCCTTCCCACGTTAGGGCCGCGGGCGCAGAGTCGGCGGGCGGCGCCCCGCGGAGGACAGCGCGTTGGCGG
CCGCGGCCGCCC
Sequence Type mRNA
Unitrap ID UNI2811

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 21728008..21728075 68
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000047368 (5730446C15Rik) NM_146096 family with sequence similarity 108, member B Gene [Source:MGI Symbol;Acc:MGI:1917816]

 
Come back to gene ENSMUSG00000047368


For any suggestions or comments, please send an email to unitrap@crg.es