Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14338A8
Clone ID IST14338A8
Vector VICTR74
Project tigm

Sequence tag IST14338A8BBF1
Sequence
CTTACACTCCATCTGGGCNAGGAAAAAGGATCACTTTCCACAGCCCANAAAGCCTGTACATCGCATGATCTCCCAAACCA
CTTTGAAGCTCCCGGCGCTGGGCCTGGAGAGGCGGTCCTCTGTCTCGTTCCACTCCTCTAGAACCGGTTCCTTTCTCAGC
ATANAANATAGCTTCATCTCTATCCTTGCTAAATCTCCAAGGCCTCCGACACTCGAGAAATTATCCCGGGAAGCTGAGGA
ATTCTCTTGCCCATCCTGAGTGCTGACCGGGGACCAGTTTTAGGGCTGGAAATCACANCANCNNNAGAGGAAGGGATAAN
GTGTTGAANTNGGCGGGANTNANGGANGCNCCCNNCTGTGCNGTCGCTCTCCTCTCNCNNANCATTCNAANGANTGCCTG
GGAANANANNNCNNAGTTGTCTCNNTTAAANGTGCTGTTGTGCNNNANTTCCTGTGNNNGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14338A8HMF1
Sequence
CTTACACTCCATCTGGGCCAGGAAAAAGGATCACTTTCCACAGCCCAGAAAGCCTGTACATCGCATGATCTCCCAAACCA
CTTTGAAGCTCCCGGCGCTGGGCCTGGANAGGCGGTCCTCTGTCTCGTTCCACTCCTCTAGAACCNGTTCCTTTA
Sequence Type genomic DNA
Unitrap ID UNI32360

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 130997066..130997219 150
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027329 (Spef1) NM_027641 sperm flagellar 1 Gene [Source:MGI (curated);Acc:Spef1-001]


Sequence tag IST14338A8HMR1
Sequence
TAAGGAGGAGGATNAGTCCCCGGCCTCGGCGTTGAGCAACCCCACGTTCGCTCGAACCCTCCGCAGCCGAGCGCCGTAGC
TGCAGGAGGCACTANTGAGCANCTCGCTCCGCCCTCCCAACCCTGCGTCGGCAGGTGAGTGGGTGGNTCNCGGCGTCTGN
NCTCNGGCNGNTACTGNNNANCCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000027329


For any suggestions or comments, please send an email to unitrap@crg.es