Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10083D1
Clone ID IST10083D1
Vector VICTR75
Project tigm

Sequence tag IST10083D1BBF2
Sequence
TTGACCAATCCAGCTTTAATATGTTTACTTATATCCATGGTTTGCAATTGCTTGAAACTGTTCCTTTTTTACATACCACT
AATTCTTTAACAGGAGAAGCAACTGAAAATGTAATTAGTTATTGCCTGATTGATCACATTGTGAACCCTGAGCATGTGAA
CAAATCCCATTTCTTAGGCTGGAAAGATGGCTCAGTTAAGAGCACTTCCAGAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 88830557..88830773 215
NO GENE  


Sequence tag IST10083D1HMF3
Sequence
TTGACCAATCCAGCTTTAATATGTTTACTTATATCCATGGTTTGCAATTGCTTGAAACTGTTCCTTTTTTACATACCACT
AATTCTTTAACAGGAGAAGCAACTGAGAATGTAATTAGTTATTGCCTGATGGATCACATCGAGAACCCTGAGCATGTGAA
CAAATCCCATTTCTTAGGCTGGAAAGATGGCTCAGTTAAAACCACTTCCAGAGATCTTCCAGGTCCAGAGGCCCTGAGTT
CAATTCCCAGCAACCACAGGGTAGCTCACAACATCTGTAATGGGATCTGATACACGCTCTTCTTCTTCTTCTTCTTCTTC
TTCTTCTTCTTCTTCTTCA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 88830557..88830895 315
 
EST/CDNA Est Name
  DV649419.1


Sequence tag IST10083D1BBR1
Sequence
GGCAAAGCATGAAAGAGCACCGGTACCTCCTGTTGGGCATTTAGGATAAAAGACTAGGCAAACCACACCAATGCTTGCTT
GTACAGGGCTTGGGGGGGCAAGCCTGGGGTGGGATCCGT
Sequence Type genomic DNA
Unitrap ID UNI23198

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 75393831..75393948 114
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000901 (Mmp11) NM_008606 matrix metallopeptidase 11 Gene [Source:MGI (curated);Acc:Mmp11-002]

 
Come back to gene ENSMUSG00000000901


For any suggestions or comments, please send an email to unitrap@crg.es