Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14169D4
Clone ID IST14169D4
Vector VICTR74
Project tigm

Sequence tag IST14169D4BBF1
Sequence
CTTANTNNNNTCTANANAANNNGCAANNGTNNNNNCNANTTTAACACATTTACTTATCNCAAAGANAAATAATAAGCATG
CTCTTGTCACNTCATACCCCANCACACGTGGAAGCCCTAANAAATCACAAGTCTTGCTACCCCTATAAAATTGTCTGCTC
TGGATACGATTTAGAAACAGCATCACATAAATACAGACTTTTATATCTGGATTTTTAAACCCTACACATTTCTGAGGCTC
AAATATAATATATATCAGTATTTCTTGTTTATTTGGGGTTTTGTTTTTCTTANACACAGTGCATGTTATGTANTCTGGCT
GTCCTANAACTCANTATGTANACCATGCTAACCTCTCACAGAGACCCACCTGTTTCTGCCTCCCAAGTTCTGGCAATAAA
AGTGTGTGTGTCNNNNTGCNCAGCCTCCTTCCCTTCTTGANTAACATACATANANCACATATTTNACTTATCTNGTCNTC
AGANGATGCTGATANACNNTTNNNGNTTTTCCCCTCNTNNGTNTNNNTTNNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14169D4HMR1
Sequence
NNAGAACCNGTGAATTGTACACTACCATGGGTAGATTGTGTGATAGAGGTCAGCTCAGTAAAGCTGTTACTGAAAGCATA
GGCTTAGTCTGAGATGGCTCTTTGAGTAAAAGCTTT
Sequence Type genomic DNA
Unitrap ID UNI13623

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 107913530..107913643 112
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032594 (Ihpk1) NM_013785 inositol hexaphosphate kinase 1 Gene [Source:MGI Symbol;Acc:MGI:1351633]

 
Come back to gene ENSMUSG00000032594


For any suggestions or comments, please send an email to unitrap@crg.es