Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10256A12
Clone ID IST10256A12
Vector VICTR76
Project tigm

Sequence tag IST10256A12BBF1
Sequence
NTCCCAGCACTTGGGAGGCAGAGGCAGGCGGACTTCTAAATTCGAGGCCAGCCTGGTCTACAAAGTGAGTTCTAGGACAG
CCAGGGCTACACAGAGAAACCCTGTCTCGAAAAACCNAAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI34450

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 68308229..68308354 118
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034912 (Mdga2) NM_207010 MAM domain containing glycosylphosphatidylinositol anchor 2 Gene [Source:MGI Symbol;Acc:MGI:2444706]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 84957741..84957866 118
NO GENE  


Sequence tag IST10256A12HMF1
Sequence
ATCCCAGCACTTGGGAGGCAGAGGCAGGCGGACTTCTAAATTCGAGGCCAGCCTGGTCTACAAAGTGAGTTCTAGGACAG
CCAGAGCTACACAGAGAAACCCTGTCTCANAAA
Sequence Type genomic DNA
Unitrap ID UNI14730

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106528565..106528677 111
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020717 (Pecam1) NM_008816 platelet/endothelial cell adhesion molecule 1 Gene [Source:MGI (curated);Acc:Pecam1-002]

 
Come back to gene ENSMUSG00000020717


For any suggestions or comments, please send an email to unitrap@crg.es