Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14434B4
Clone ID IST14434B4
Vector VICTR74
Project tigm

Sequence tag IST14434B4HMR1
Sequence
GGAGTAATCACTGAATGGGTTCTGCCGAATGTAATTGTGCCGATTGTAATCATTTTGCTCCAGCTCTCTGCCCCTGTGAC
ATTTATTTCTTAGCCCAGATATTGATCTAACAGTGGGAAATTTTCCATCTGAATCCGTGATGCCGGACCCTCCCCAAGTC
CGAAGATGTGTTTGGGAAATTCTCATTTTCCCTGGATCACAGCNNNNNNNTNNGNCCNGGNGGGAANCNTGCNCCGTTGG
ANAAACNCCTTGGATCNGANAGAGAT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14434B4BBF1
Sequence
CTCCTAGGGTTGGGGAGCTCCGGCTTCATCCACCACGGGACGGCTTGGGAATTAGAACATCACTCAGCATTTCATAATTC
GACAGATTTGCCCGTTGTCTTGGCACGAGTTCATTTTCCCCACACAATACGTCTCTGTAAATGGAGTTCTGTTCAAGGAA
AGAAGGAAGGTAGGAAGGAAAGCCTGGGTGGGAGAAGGCAAACTAAGCCAGAGTACAGGAGAGGCCAAGGCTGTGATATT
GCATGCAGAGCTTAAGAGACACTCTGTGGAATGTGGACCAGAGTGCTGACGACATCTGTCTGCTTANAAGAGCTGTAAGC
CNTATCTTTCCCACNNTTCTACTTANCCNGGANCCCATCANGTNAAAAGGTTCAAGAGCACCTGANTANGTGCAGGGGGT
ACANGGCCTGAANTCN
Sequence Type genomic DNA
Unitrap ID UNI13754

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 77699371..77699784 387
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017453 (Pipox) NM_008952 pipecolic acid oxidase Gene [Source:MGI (curated);Acc:Pipox-001]


Sequence tag IST14434B4HMF1
Sequence
CTCCTAGGGTTGGGGAGCTCCGGCTTCATCCACCACGGGACGGCTTGGGAATTANAACATCACTCAGCATTTCATAATTC
GACAGATTTGCCCGTTGTCTTGGCACGAGTTCATTTTCCCCACACAATACGTCTCTGTAAATGGAGTTCTGTTCAAGGAA
AGAAGGAAGGTAGGAAGGAAAGCCTGGGTGGGAAAAGGCNNACTANGCCAGAGTACNNGANAGGCCNANGCTGTGATATT
GCNTGCNNNNCTTANNANACNCTCTGTGGAATGTGNACCANANTGCTGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000017453


For any suggestions or comments, please send an email to unitrap@crg.es