Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13986E2
Clone ID IST13986E2
Vector VICTR74
Project tigm

Sequence tag IST13986E2BBF1
Sequence
GCTTTAAATCTTATTTTAAATTTTACTATTTAGGATACGAACCACATTAATTATTACCTAAACTAGAAATATCTTTAGAG
ACCCAGCCTCTTGGGCTGCCTTATGCCATGTGTCGGAAGGACTCTAAACTTGAGTTATTAAATTTAACACTAACCATCTG
TAGCAATGTAACAATTATTAATCTTAACCAACAACTTATGAGCTGATTGTGAAAACACTCAGAGCACATTATCAATAAAA
AAGAACCAAATGAAGCAGTTACATTTAGACCAATCAGAGAATAATAATTTTTGTAGCTACAACCNTAAAAATANNAAACA
CTTTACCNTTGTCNAACACATTAATCNTGAACNNTTTACNAGCTTTTTTACTCNGAAACTTANAGGCTGTGCACTCGCCC
TTATTTNCTAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 136938286..136938698 389
 
EST/CDNA Est Name
  AW549398.2 - AW549465.2
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 124751254..124751666 389
 
EST/CDNA Est Name
  AI153827.1


Sequence tag IST13986E2HMF2
Sequence
GCTTTAAATCTTATTTTAAATTTTACTATTTAGGATACGAACCACATTAATTATTACCTAAACTAGAAATATCTTTAGAG
ACCCAGCCTCTTGGGCTGCCTTATGCCATGTGTCGGC
Sequence Type genomic DNA
Unitrap ID UNI16988 UNI31842

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166370: 32827..32942 116
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_161872: 823173..823288 116
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 38948177..38948292 116
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048720 (Tbc1d12) NM_145952 TBC1D12: TBC1 domain family, member 12 Gene [Source:MGI Symbol;Acc:MGI:2384803]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 9893373..9893488 116
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 40718388..40718503 116
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 81748992..81749107 116
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 23267659..23267774 116
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 28107479..28107594 116
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 15072133..15072248 116
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 7803810..7803925 116
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 50223173..50223288 116
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 24049948..24050063 116
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 5222925..5223040 116
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 3112791..3112906 116
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 19284226..19284341 116
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 130151326..130151441 116
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 40554176..40554291 116
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 3327866..3327981 116
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 15920644..15920759 116
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20420736..20420851 116
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 7467858..7467973 116
NO GENE  

 
Come back to gene ENSMUSG00000036617


For any suggestions or comments, please send an email to unitrap@crg.es