Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15075D12
Clone ID IST15075D12
Vector VICTR80
Project tigm

Sequence tag IST15075D12BBF1
Sequence
TTTATATGTAAGTACACTGTAGCTGTCTTCAGACACTCCAGAAGAGGGCACCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI2772 UNI20442 UNI35282 UNI35283

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 36877046..36877102 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 83199332..83199388 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 94347286..94347342 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 43861906..43861962 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 56546818..56546874 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 79995473..79995529 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003341 (Atp8b3) NM_026094 ATPase, class I, type 8B, member 3 Gene [Source:MGI Symbol;Acc:MGI:1914581]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 114287169..114287225 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 54080459..54080515 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 30391199..30391255 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025747 (Tyms) NM_021288 thymidylate synthase Gene [Source:MGI (curated);Acc:Tyms-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 148626228..148626284 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063077 (Kif1b) NM_207682 kinesin family member 1B Gene [Source:MGI (curated);Acc:Kif1b-003]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 93207427..93207483 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7490726..7490782 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 85121667..85121723 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 145507919..145507975 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026361 (AC175246.2) NM_145991 Parafibromin (Cell division cycle protein 73 homolog)(Hyperparathyroidism 2 protein homolog) [Source:UniProtKB/Swiss-Prot;Acc:Q8JZM7]


Sequence tag IST15075D12HMF2
Sequence
TTTATATGTAAGTACACTGTAGCTGTCTTCAGACACTCCAGAAGAGGGCACCAGATCTTGTTAGGGATGGTTGTGAGCCA
CCATGTGGTTGCTGGGAATTGAACTCACGACCTTCAGAAGAGCAGTCAGTGCTCTTAACCGCTGANCCATCTCTCCAGCT
CCAAGAGATATTTCTTTTTTTAAAAAAATATTTATTTATTTATTATATGTAAGTACACTGAAGCTGTCTTCAGACACACC
AGTCAGATCTCCTTACGGATGGTTGTGAGCCACCATGTGGTTGCTGGGACTTGAACTCAGGACCTTCAGAANANCAGTCG
GGTGCTCTTACCCGCTGAGCCNTCTCACCAGCCCCTATGGTTGTGANTTTTGTAAAATACATTTTTTTTTGGTTGTGGTC
TTTTGTTTCNTGGANNGCNNCTCCTANATCCTTGGANTATTCNAANNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 7490339..7490782 411
NO GENE  

 
Come back to gene ENSMUSG00000026361


For any suggestions or comments, please send an email to unitrap@crg.es