Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST9542-NR
Clone ID PST9542-NR
Vector U3NeoSV1
Project escells

Sequence tag PST9542-NR
Sequence
CCAGTAACATCCAACAACATCCAAGATCCTGAGTGGTCCATTGAGGGTGGAGGGGCGGCATCACTTAGGTGCGGCGTGTG
TTTGGTGATGGATAGCCAGGTTTTTTTGTTTTGTTTTGTTTGAGTGTCTTGTTTCTGATAGGAGCTAATCTCTCATCGTA
ACCAGGAATAAGGTGGGAATTGGCGCCTGCATTGCTGTAGGGAGACTTACAGCAAGCCCTTGCTGGGCTTTGAGAACCTT
TCTCCCTGTGAGATGCCTAAGCG
Sequence Type genomic DNA
Unitrap ID UNI15535

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 165636778..165637040 263
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039671 (Prkcbp1) NP_081506 protein kinase C binding protein 1 Gene [Source:MGI (curated);Acc:Prkcbp1-010]

 
Come back to gene ENSMUSG00000039671


For any suggestions or comments, please send an email to unitrap@crg.es