Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AG0465
Clone ID AG0465
Vector pGT0lxr
Project sanger

Sequence tag AG0465
Sequence
GGTTCAGGCATTAAAGTCTGAGGTCGACACAACCTGATATGAGCAAGTCCTCCTGGAGAAGGAAATGGGAACGTACCTGG
GAACCTTTGATGATTACCTGGAGTTGTTCCTGCAGTTTGGCTATGTGAGCCTTTTCTCTTGTGTTTACCCGCTAGCAGCT
GCCTTTGCTGTGTTAAATAACTTCACTGAAGTCAACTCAGATGCCTTGAAAATGTGCAGGGTCTTCAAACGGCCATTTGC
AGAACCTTCGGCCAGTATTGGCGTATGGCAGTTGGCTTTTGAAACGATGAGCGTTATATCCGTGGTCACTAACTGTGCTC
TGATTGGAATGTCACCACAAATGAATGCAGTCTTTCCAGAATCCAAAACAGACCTTGTTCTGATTGTGGTGGCCGTAGAG
CATGCACTCTTGGCTCTGAAGTTCATACTCGCATTTGCCATCCCTGATAAACCACGGCACATCCAACAGAAACTGGCCAG
ATTGGAATTCGAATCTTTGGAGGCACTCAAGCAACAG
Sequence Type mRNA
Unitrap ID UNI2815

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 122110889..122166252 194
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037949 (Ano10) NM_133979 anoctamin 10 Gene [Source:MGI Symbol;Acc:MGI:2143103]

 
Come back to gene ENSMUSG00000037949


For any suggestions or comments, please send an email to unitrap@crg.es