Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14295B3
Clone ID IST14295B3
Vector VICTR74
Project tigm

Sequence tag IST14295B3BBF1
Sequence
CACCATACACTCAATAAAATAAAATAAAATAAGATAAG
Sequence Type genomic DNA
Unitrap ID UNI14655

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 42497141..42497177 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032017 (Grik4) NM_175481 glutamate receptor, ionotropic, kainate 4 Gene [Source:MGI (curated);Acc:Grik4-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 8246144..8246180 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 157547810..157547846 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 38515242..38515278 35
NO GENE  

 
Come back to gene ENSMUSG00000032017


For any suggestions or comments, please send an email to unitrap@crg.es