Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10218H12
Clone ID IST10218H12
Vector VICTR76
Project tigm

Sequence tag IST10218H12BBF1
Sequence
GTGTGTGTGTGTGTGTATTGTGTGTGTGTATTGTGTGTGTGTGTGTNTNTTGNGTGTGTTNTGTGTGTATGTGTGTGTGT
GTGTAGTGTGTGTGTGTGTGTGTNTTGTGTGTGTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST10218H12HMF1
Sequence
TTGCCATGAAGCCTAAGCCATAGGCACTGCGGCTGCGCGCTGACTTGCGGCGCTTTANCCTGGAAGGAGTTAAGGCATTC
AGAGCACTGCGGCTGCGCACTGNGGCTGGGGGAGCTGTCCATGGTTCTGGCCGCCTCGCGCCCTCCTCCGGGCCGGGTCA
ACGCCTCG
Sequence Type genomic DNA
Unitrap ID UNI35285

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 51849249..51849408 154
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000062785 (Kcnc3) NM_008422 potassium voltage gated channel, Shaw-related subfamily, member 3 Gene [Source:MGI (curated);Acc:Kcnc3-001]

 
Come back to gene ENSMUSG00000062785


For any suggestions or comments, please send an email to unitrap@crg.es