Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11177C12
Clone ID IST11177C12
Vector VICTR76
Project tigm

Sequence tag IST11177C12BBF1
Sequence
TACAGAGTGAGTTCCAGGACAGCCAGGGTTACACAN
Sequence Type genomic DNA
Unitrap ID UNI13538 UNI30772 UNI31392 UNI33575 UNI34813 UNI34814 UNI35286

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_109319: 106977..107011 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166303: 128061..128095 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166437: 36643..36677 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166435: 49708..49742 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5419103..5419137 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 34469861..34469895 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000005871 (Apc) NM_007462 adenomatosis polyposis coli Gene [Source:MGI Symbol;Acc:MGI:88039]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 35230341..35230375 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007036 (Bat5) NM_178592 HLA-B associated transcript 5 Gene [Source:MGI Symbol;Acc:MGI:99476]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 40375013..40375047 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 23562592..23562626 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 9781068..9781102 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 4774285..4774319 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4069896..4069930 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002129 (Sf3a1) NM_026175 splicing factor 3a, subunit 1 Gene [Source:MGI (curated);Acc:Sf3a1-003]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 12550771..12550805 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 8701587..8701621 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025278 (Flnb) NP_598841 filamin, beta Gene [Source:MGI Symbol;Acc:MGI:2446089]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 58308150..58308184 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037990 (Sh3rf3) NP_766376 SH3 domain containing ring finger 3 Gene [Source:MGI Symbol;Acc:MGI:2444637]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 27292099..27292133 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 19612629..19612663 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 19978163..19978197 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000030400 (Ercc2) NM_007949 excision repair cross-complementing rodent repair deficiency, complementation group 2 Gene [Source:MGI (curated);Acc:Ercc2-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 5232127..5232161 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 47397473..47397507 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007613 (Tgfbr1) NM_009370 transforming growth factor, beta receptor I Gene [Source:MGI (curated);Acc:Tgfbr1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 20803460..20803494 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 22527235..22527269 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 4797698..4797732 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 22360841..22360875 35
NO GENE  


Sequence tag IST11177C12HMF2
Sequence
CTACAGAGTGAGTTCCAGGACAGCCAGGGTTACAC
Sequence Type genomic DNA
Unitrap ID UNI13538 UNI31392

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_109319: 106978..107012 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166303: 128062..128096 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166437: 36642..36676 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_166435: 49709..49743 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 5419102..5419136 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 12828103..12828137 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 6102808..6102842 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 40375012..40375046 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 23562591..23562625 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 9781067..9781101 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 4774284..4774318 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4069895..4069929 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000002129 (Sf3a1) NM_026175 splicing factor 3a, subunit 1 Gene [Source:MGI (curated);Acc:Sf3a1-003]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 12550770..12550804 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 8701586..8701620 35
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025278 (Flnb) NP_598841 filamin, beta Gene [Source:MGI Symbol;Acc:MGI:2446089]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 18871672..18871706 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 27292098..27292132 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 28996430..28996464 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3380346..3380380 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 3933893..3933927 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 8769307..8769341 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 20803459..20803493 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 12599182..12599216 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 3584772..3584806 35
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 7995209..7995243 35
NO GENE  

 
Come back to gene ENSMUSG00000025278


For any suggestions or comments, please send an email to unitrap@crg.es