Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15002F7
Clone ID IST15002F7
Vector VICTR78
Project tigm

Sequence tag IST15002F7HMR1
Sequence
GTGCACACACAAAGGTAATTTTAAAAATTCAGAGCCATGGTGAAATTTCTATTTATATACTGACAGACACTCAGGCAATC
CAAATGCCTTTGTCTAAACACTTACAGGAATTTCCACGTATATCTTTCCTAAAGTAAATATTTTTAAATCTTANTTATCT
TCGCTGAGAAGAAATCGATCCTGAGATAAGCTGATACGCANAATAATTTATTANATGTCTCAAGTGGCAAAACCCCAGCT
TTGCGAGGGGAGAAAGAATGTGACTTAAGTATCTGTTCTTAAAAGCAGTAAAAATAGCCTAAGAGAACTATTAACCTCAA
GGATAAATTAAATGTATACATTTGGTGGGCCCAAGTATGTGGTAAACCTTANTATAGTAGGGTTTTGCTTTTGTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30987245..30987640 388
 
EST/CDNA Est Name
  CD550220.1 - BE288421.1 - BY241837.1 - BY237845.1 - BB850099.1 - CJ186961.1 - BY237301.1 - BY289585.1 - BY297428.1 - BY215370.1 - BY130346.1 - BY216838.1 - BY233334.1 - BY209407.1 - BY015615.1 - BY268166.1 - BY127928.1 - BY338249.1 - BY343807.1 - BY220999


Sequence tag IST15002F7HMF2
Sequence
CACACTCAGGCACACACATATAAAGCAAAAAAAAAAAAAAAAAAN
Sequence Type genomic DNA
Unitrap ID UNI29473

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 30987641..30987684 44
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075415 (Fnbp1) NM_019406 formin binding protein 1 Gene [Source:MGI (curated);Acc:Fnbp1-001]


Sequence tag IST15002F7BBF1
Sequence
ATGCTTANAGTGAATCTGGTGCTGGGGATGAACTCAAAGAGGGCNCCNTACCTTTATAGANCGGGGAANCTGTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000075415


For any suggestions or comments, please send an email to unitrap@crg.es