Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST7202-NR
Clone ID PST7202-NR
Vector U3NeoSV1
Project escells

Sequence tag PST7202-NR
Sequence
CTCCTTCCAAACCCCAAACAAGTGTACACAGTTTAAGTCATTCATTCTTATAGCTAGCATCTGGAGCCAAGGTCTGAAGC
TCATTGTCTGTACAGAGTCAGCCCAGTACTCAGGCTATGTAAATGGTAGAACCAAGAGGCTGCTAGGCTGTGTGTGCCAC
GGTGCTCAGGTGCGTGTTGTGATGCTCGGGTGTGTGCAGCGATGCTCGGGTGTGTGCAGTGATGCTCGGGTGTGTGCAGC
GGTGCTTGGGTGTGTGGAGCGCTAGGAAGTGTGTG
Sequence Type genomic DNA
Unitrap ID UNI10653

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 122658417..122658690 271
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000012396 (Nanog) NM_028016 Nanog homeobox Gene [Source:MGI (curated);Acc:Nanog-003]

 
Come back to gene ENSMUSG00000012396


For any suggestions or comments, please send an email to unitrap@crg.es