Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14481C12
Clone ID IST14481C12
Vector VICTR74
Project tigm

Sequence tag IST14481C12BBF1
Sequence
CCTGGANAGCCGAGATGAGAAGCCTGGGGGCAGGTGGGTTCTGAGTGGAGACNCCAAGANAGGGAGTCNAGAGTACAGGA
AATGTGCGTGGTACCTGGAAATGTGCGTGGTCTTCCGCAGGANAATGGCGTGTGCNATTGACGGGTGGGGANANANNTNN
NAAAGGGGTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14481C12HMF1
Sequence
ACCTGGANAGCCGAGATGAGAAGCCTGGGGGCAGGTGGGTTCTGAGTGGANACNCCNNNAGAGGGAGTCNNNNNTACNGG
ANATGTGCNTGGTACCTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14481C12HMR1
Sequence
NGTCACCTCTCCTTCCCTCTCCAGGCTACCCCTCCTTCCCTTGCTTCCTCCAGACAGACTCAGGGTTCTGGAACTGTGGC
N
Sequence Type genomic DNA
Unitrap ID UNI35291

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 106351134..106351212 79
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042073 (Abhd14b) NM_029631 abhydrolase domain containing 14b Gene [Source:MGI Symbol;Acc:MGI:1923741]

 
Come back to gene ENSMUSG00000042073


For any suggestions or comments, please send an email to unitrap@crg.es