Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10672G7
Clone ID IST10672G7
Vector VICTR76
Project tigm

Sequence tag IST10672G7HMF1
Sequence
GTTGGAGACTAGATTTTGCTCATGTCCATACTTCCGGAGGACTACTCCTGGGCCTGGTACAGTGAGTGCTGGTTAATCGT
ANATTACAAACCCAATTCAAACCACCCAAAGGACAAGTGTCCAAGGCAGTATCCCTTCAAGGTCATTTAGGATATCACAG
AATTAGATTCANATGACTTAATCACTACACAACTTGGGGCTAGGAAGATAGCTCTGAAGGTAGGGACAAGGGATCCACAC
AGCANACTGGATGAGGAACCTANCCATGTATGGGAGCTCTGANTTTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 103796008..103796295 278
 
EST/CDNA Est Name
  CJ076153.1 - BY290978.1 - CJ158201.1 - BY253917.1 - BY252809.1 - BY290289.1 - BY237824.1 - BY274297.1 - BY003450.1 - BY250608.1 - BY251035.1 - BY265881.1 - BY239042.1 - BY289744.1 - BY273828.1 - BY289755.1 - BY270706.1 - BY238163.1 - BY292187.1 - BY032189


Sequence tag IST10672G7BBF1
Sequence
GTTGGAGACTAGATTTTGCTCATGTCCATACTTCCGGANGACTACTCCTGGGCCTGGTACAGTGAGTGCTGGTTAATCGT
ANATTACAAACCCAATTCAAACCACCCAAAGGACAAGTGTCCAAGGCAGTATCCCTTCAAGGTCATTTAGGATATCACAG
AATTANATTCANATGACTTAATCACTACACAACTTGGGGCTAGGAAGATAGCTCTGAAGGTAGGGACAAGGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 103796008..103796242 227
 
EST/CDNA Est Name
  BY123064.1 - BY124081.1 - BY317832.1 - BY127453.1 - BY126612.1 - BY125280.1 - BY098240.1 - BY109168.1 - CJ087929.1 - BY778167.1 - BY125406.1 - BY048316.1 - BY127208.1 - BY128893.1 - BY294269.1 - BY326858.1 - BY278333.1 - BY129364.1 - BY124848.1 - BY331188


Sequence tag IST10672G7HMR1
Sequence
AACCTTAAGAATTATCCTAGGTATGATTCAAGTGTGTAGGCAGACAGTGAAGGTCATCTTCAGGGCTTCCATGCNTGTCT
TCTCAGTTCTGTGGGGAGGGGCAGCTGTCCAGAATGTCTCCTAGAATAAGTATTGTCTAAGCTGAGAACTGTAGAGTGTA
TAANAATTGGCCAN
Sequence Type genomic DNA
Unitrap ID UNI32838

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 103795838..103796010 169
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034187 (Nsf) NM_008740 N-ethylmaleimide sensitive fusion protein Gene [Source:MGI (curated);Acc:Nsf-001]

 
Come back to gene ENSMUSG00000034187


For any suggestions or comments, please send an email to unitrap@crg.es