Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14747D7
Clone ID IST14747D7
Vector VICTR76
Project tigm

Sequence tag IST14747D7BBF1
Sequence
GGCTTTGCAAAGATATGATGGATTCTGTTTTGTTTTTTTGAGACAAGTATCACTATGTAGTCCAGGCTGGCTTGTAACTC
TCCTTGTAGACCAAGCTGGCCTTGAATTCACAGAGTTCCAGGCCTCTGCTTCCTAAGAGCTTAGCTTAATGGTGTGTTTC
CCCTTGTCTTACCTATTTGATTTTAATTACGTGTGCGCTATGGAGGCAGAAGAAGGTGTCAGATCCCTTAGAGCTAGAGT
TATAGACTACTGTGACTGTGAGCCACCTAGTGTGACCTCTAAGAACCAAACTGGAGCCCTCTACAAAAGCAATACNTCCT
CTTAATCACTGAGCCATCTCTCCANCCCTCCCCAGAAAAAGTTCCGGTTTTTTGTTTCTTNTTTNTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 121993195..121993585 383
 
EST/CDNA Est Name
  DV552053.1 - BQ937081.1


Sequence tag IST14747D7HMR1
Sequence
GCCTATCNATTTGTATCCNGTGCTCAGAGATAATTGCTACTTATTCAAACCACCATCACCACATAAGATGGTAAGTTGGG
TTTTATATATTTAATAATTTTTGTTAAAAAATTGGACACTTGGTAACATAGTAACTCTGGACTTTCACTCTTCCCGGTAT
TTGTAGCTGCCTANAATTAAAGGGAAGTTTATTTTCCTTGTGCATGCTAATGTCAGATCAGGGCTGTTGTTCTTGGCCTC
TGANTAAGTTAGCTTCTGATGTGGGCTGANACTATCCAGTGATTTGAACTCCTGANGCTTTTACCCCCTGCCATTCAACC
CCTGTGGTTCTGGAGTCCTTTCTGAATGGANTTC
Sequence Type genomic DNA
Unitrap ID UNI24993

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 121992845..121993197 339
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029454 (Mapkapk5) NM_010765 MAP kinase-activated protein kinase 5 Gene [Source:MGI (curated);Acc:Mapkapk5-005]


Sequence tag IST14747D7HMF1
Sequence
TTCNNNTTTGTTTTTTTGAGACAAGTATCACTATGTAGTCCAGGCTGGCTTGTAACTCTCCTTGTAGACCAAGCTGGCCT
TGAATTCACAGAGTTCCAGGCCTCTGCTTCCTAAGAGCTTAGCTTAATGGTGTGTTTCCCCTTGTCTTACCTATTTGATT
TTAATTACGTGTGCGCTATGGAGGCAGAAGAAGGTGTCAGATCCCTTAGAGCTAGAGTTATAGACTACTGTGACTGTGAG
CCACCTAGTGTGACCTCTAAGAACCAAACTGGAGCCCTCTACAAAAGCAATACATCCTCTTAATCACTGAGCCATCTCTN
CAGCCCTCCCCAGAAAAAGTTCCGGTTTTTTGTTTCNTTTTTTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 121993223..121993584 358
NO GENE  

 
Come back to gene ENSMUSG00000029454


For any suggestions or comments, please send an email to unitrap@crg.es