Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14520E12
Clone ID IST14520E12
Vector VICTR74
Project tigm

Sequence tag IST14520E12BBF1
Sequence
AAACATTTCCTAGCTGGGCGTGTTGGCGCACGGCTTTAATGCCAGCACTTGGGAGGCAGAGGCAGGCGGATTTCTGAGTT
AGAGGCCAGCCTGGTCTACACAGTGAGTTCCAGGACAGCCAGGGCTATACAGAGAAACCCTGTCTCAAAAAAACAAAAGA
ACAAAACAAAACCAAAAAAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA
GAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGATTTCCTGCTCCTTCAC
TCAATCCAAAGCAGNNCTGGGCCTCTACNAGANGAGCTGCTGTCCTANGGGCTGGGGATTACACGGTGCTCAGGANTGCA
CAGCTGGGCANAGACNNNAAAGGNCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 72463279..72463701 403
 
EST/CDNA Est Name
  BY638315.1 - CK623830.1 - BQ943302.1 - CJ088384.1 - CJ072229.1 - CJ079383.1 - BY103267.1 - BY032147.1 - CB273624.1 - BU919146.1 - BY282871.1 - BY266938.1 - CJ080238.1 - BY076495.1 - CJ162362.1 - BY344647.1 - AV142371.1 - CJ172804.1 - BB610949.1 - CJ090595


Sequence tag IST14520E12HMR1
Sequence
GTTTCTCTTTACCTTCTCTTTCCCCCTCTTAGCATCCCCTTCTTTCCCTCTCACAGTGCTAAGGTTCCCCCAGTTACAAA
CATCAGCTGTCGGTTTTGTCCGTGCCACTTATTGCCACTCCTCCATTCATGTCTGCAATACACATTGTGAAGTCTTACTA
ATTGAAGTTGAGCTGCCACAGTCAGAAGGACACCAAAGTCTANNATGTTC
Sequence Type genomic DNA
Unitrap ID UNI471

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 72463074..72463282 205
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036180 (Gatad2a) NM_145596 GATA zinc finger domain containing 2A Gene [Source:MGI Symbol;Acc:MGI:2384585]

 
Come back to gene ENSMUSG00000036180


For any suggestions or comments, please send an email to unitrap@crg.es