Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14683G12
Clone ID IST14683G12
Vector VICTR74
Project tigm

Sequence tag IST14683G12HMR1
Sequence
CTAGAATGGCCGCACAGACACCGTGTTCGCTGTGCTAAGCTGCATCTATGT
Sequence Type genomic DNA
Unitrap ID UNI1451

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 65619936..65619986 51
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040524 (Zfp609) NM_172536 zinc finger protein 609 Gene [Source:MGI Symbol;Acc:MGI:2674092]


Sequence tag IST14683G12HMF1
Sequence
CTAGTGCTTTCAGTGCTACTCTCTCATTTTGGGATCAACAGTCCTCTAGGTGGCTAACAGGTTTTTTTTGTTTTGTTTTG
TTTTGTTTTAACAGTGANACTGTCTGACTATACTTCAAGTTAGCAAAGAACTCATTACATAGCCCAGGCTGGTCTCAAAC
TCAAGCAATCTTCCTGACTCAGCCTTCTGAGTGCATGATTCACTTGTGTGTTATGCAATCCACTGGCTGCACAGCANAAC
CAATGCTACTAAATAATACGCTAGTACGCACAGAGGAATGATACTCATTAAGAGAAAGAACCAGTAAAGCTGTGTATGAT
GGCTCACACCTGCTATCACACCTGCTAGCACAGCACCTGCGATGCTAAGACAGANGGAAGGCCNNTTCTC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 65619983..65620371 379
NO GENE  

 
Come back to gene ENSMUSG00000040524


For any suggestions or comments, please send an email to unitrap@crg.es