Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12963C10
Clone ID IST12963C10
Vector VICTR76
Project tigm

Sequence tag IST12963C10HMF2
Sequence
AGAGCACCCGACTACTCTTCCAAAGGTCCGAAGTTCAAATCCCAGCAACCACATGGTGGCTCACAACCACCTGTAACAGA
GATCTGATGCCCTCTTCTGGTGCGTCTGAAGACAGCTACAGTGTACTTACATATAATAAATAAATAAATAAATCTTTTAA
AAAAAANANAGAGATAACTGATTTAAAAAAAAAAAAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 96323302..96323498 193
NO GENE  


Sequence tag IST12963C10BBF1
Sequence
NGAGCACCCGACTACTCTTCCNAAGGTCCGAAGTTCAAATCCCANCAACCACATGGTGGCTCACAACCACCTGTAACAGA
NATCTGT
Sequence Type genomic DNA
Unitrap ID UNI35294

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 96323413..96323497 79
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 33901066..33901150 79
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 19224965..19225049 79
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037683 (Armc3) NM_001081083 armadillo repeat containing 3 Gene [Source:MGI (curated);Acc:Armc3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 143121552..143121636 79
NO GENE  

 
Come back to gene ENSMUSG00000037683


For any suggestions or comments, please send an email to unitrap@crg.es