Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14455E4
Clone ID IST14455E4
Vector VICTR74
Project tigm

Sequence tag IST14455E4HMF1
Sequence
CTGGAAATTTTAGGTTGCAACCCCAATGAATTGAGGATACCAGCCATCTTCTAAGGCTGACGATGGAACTGCTAACAAGT
CCTCTATTTCACCCCAGAATTCTGGCTTAAAGCAATGTCTAAACTTACAGTTTCACAGATACAACATGATTTGAGGCCTC
AATTTGGCTAGAAAACACACCAGAATGGTCATGTAGATAAAACAAAATCAACAGAATGTTGGTTCCTTTANAGCTGGGTA
ATGAGCACTGCACTTTGACTTCTGAGTCTGTCTGGAATTTTCCATAAAAGTTAAACAATACATCACNATATATTAAAAAA
AAAAAANNNCAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 20539229..20539554 322
 
EST/CDNA Est Name
  BE370650.1


Sequence tag IST14455E4BBF1
Sequence
CTGNAAATTTTANGTTGCNNCCCCAATGAATTGAGGATACCANCCNNCNTCTAAGGCNGACNATGGAACTGCNAANNNNT
CCTCTATTTCACCCCAGAATTCTGGCTTAAAGCAATGTCTAAACTTACAGTTTCACAGATACAACATGATTTGAGGCCTC
AATTTGGCTAGAAAACACACCAGAATGGTCATGTAGATAAAACAAAATCAACAGAATGTTGGTTCCTTTAGAGCTGGGTA
ATGAGCACTGCACTTTGACTTCTGANTCTGTCTGGAATTTTCCATAAAAGTTAAACAATACATCACTATATATTAAAAAA
AAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14455E4HMR1
Sequence
CCAGGGGACAGAAAGCCNGCAAGTGGCTATTAGAAACACATCCCACTGCTGACAGGCTTTAAAAGCCATTTTTGCTTTTN
AGATTTTTGCAATTAAGACATACTTTATTCTTCCTTATCTCTCTTTTCGTCATTCTAAAGAAACATTCACTTCTAAAAGT
TC
Sequence Type genomic DNA
Unitrap ID UNI31752

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 20539551..20539711 157
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049800 (Sertad2) NM_001038625 SERTA domain containing 2 Gene [Source:MGI (curated);Acc:Sertad2-001]

 
Come back to gene ENSMUSG00000049800


For any suggestions or comments, please send an email to unitrap@crg.es