Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14806H3
Clone ID IST14806H3
Vector VICTR76
Project tigm

Sequence tag IST14806H3HMF1
Sequence
TGCCGAACAGAATGTTTCAATCTCACTGTTTCACAGTAGAGAAAGAATCCCGAATTTCAGAATGACACACACACCCCTAT
AATCTCATTGATAGTGAGAGGCAAGGGAGATCAAGAGTTAAAGGTCAGGCTGGCAGGGATGGTGTGTTTGAGATTATCTT
AGGTAACTTGAGACCCTTTCTCAAAAGACAAACAAACAATAATCCAAACATCTATGGACAGAAAAGGAGCCCAGATAAAC
CACAAGACATTCTTGCAGTGACAACAGGAGCCACAGAGATATGCAGTAGCCATACTATGTGGTAATACTGGAATGATCAG
TGACTACTATTATTGAGGGAATAATCAGCAAAATACATACAAAGAGATTTTTCTCANGAGCTGGCTCAGCAGTTAAGAGC
ACTGACTGCTCTTCCAGAAGTCCTGAGTTCAATTCCCAGCAACNNCATGGTGGCTCANANNCATCTTTAATGGGATTCAG
TGCCCTCTTCCAGTGTGTCTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 53605968..53606468 489
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078860 (AL596182.28)  


Sequence tag IST14806H3HMR1
Sequence
NAAGGGGCTGTTTTTATTACGTAGGTGGGGTCACTGAGGTTTGGAGAAGCCNCGCTGATGAAAGCTCACCATCTTTCTTA
TCTAGCCACGGCCCCCTGACTGTCAGTCCATCCGTCCGGCTGGGACTCTAACTCCTTGTCTCTCAGGACCACTTGCCCAG
CCCACAGGCAGGCANATTTTGAGCTTANCTGATGGGGCCTCANTGCACAGCTGGAGCTGTTCTATNNGACTGACTGCCCA
TCACACCNNCTCAAANGANGTTC
Sequence Type genomic DNA
Unitrap ID UNI13261

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 97679244..97679504 241
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038366 (Lasp1) NM_010688 LIM and SH3 protein 1 Gene [Source:MGI (curated);Acc:Lasp1-001]

 
Come back to gene ENSMUSG00000038366


For any suggestions or comments, please send an email to unitrap@crg.es