Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST6518-NR
Clone ID PST6518-NR
Vector U3NeoSV1
Project escells

Sequence tag PST6518-NR
Sequence
AATACATTTTCTGCTCGGCTATCACCAAATCTTGTTTTTATTAAAAACCTGCTCTGTAACTTGTACCTTAGATTACATGA
TTTAGTTTTTTCTCGTGGAACTATGTTAAGTGAGCTATTTGGGCTAGTTGAATACTTACTGATTTTCCCATTAGCACACA
AGTGTATTCCCTATTCTAAGGATTGTAATATTAACTTTCAATAACTGCTCTTTTGTTCTCAATTCCAGTTCAGTAGCTGC
TGCTTTAACATAAGTTGATTTCTTCCAAAGACCTGGGGCAG
Sequence Type genomic DNA
Unitrap ID UNI14807

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 180265476..180265749 251
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039630 (Hnrnpu) NM_016805 heterogeneous nuclear ribonucleoprotein U Gene [Source:MGI (curated);Acc:Hnrnpu-001]

 
Come back to gene ENSMUSG00000039630


For any suggestions or comments, please send an email to unitrap@crg.es