Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11727G8
Clone ID IST11727G8
Vector VICTR76
Project tigm

Sequence tag IST11727G8HMF1
Sequence
TTCTGAGGAACCTTCTAGCCTGTGAGATCTAGAGTTAGAGATTCCCCTGCAAATAGATATCAGATCAGAGTGACTCTTGT
AGTCAGAATAACCCCTAACAGGGACAAACTAGAGGCCTCCATTCAGATCCCTACTTCTGCCAAGTATTAGCCACGTGACT
GGAGGAAATTTTGAATTATGAAATTGGTTTGAAAATAAGCCACCCCGGGGCATGCTGTGATGGTTAGTTGGTCTCAAAAC
GCGTCCCTAAACATCAGCCTTCTAGCTTTCCGCAGTGAAGCCTGGGCCACCCGCTGGGCACCTGCTCTGAGTAGGTCACA
GACACTCTTAGCTCTCACCTAGTCACTAGCAGCCNATTCCTTGACTGCTCTGCACTCCCGGGACATCTGACCCAGANGAT
CGCTGGGAAGTTCATGTTACCCTGACAGTCNAAGCTGCCAGGGATCTTGACAAAGATTCCNGCAGCNNGANCTGGTAGCC
TTGTGACNTTANGTACACTACTTAACTCTTCTGAANTACCACATTCNTATTGNGTAACTNNAAGCCGGTTTGGAGGAA
Sequence Type genomic DNA
Unitrap ID UNI18497

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 122135572..122136126 527
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028121 (Bcar3) NM_013867 breast cancer anti-estrogen resistance 3 Gene [Source:MGI Symbol;Acc:MGI:1352501]

 
Come back to gene ENSMUSG00000028121


For any suggestions or comments, please send an email to unitrap@crg.es