Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12418F7
Clone ID IST12418F7
Vector VICTR76
Project tigm

Sequence tag IST12418F7BBF1
Sequence
ATTGAATTTAGGACCTCTGCTCGCTCTGGTCAACCCCCCTCACTCTGGTCAGACCCGCTTGCTTCGGCCCAAAGATTTAT
TTATTATTATAAATAAGTACACTGTAGCTGTCTTCTGACACACCAGAAGAGGGCGCCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI14516

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 85005764..85005906 143
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020042 (Btbd11) NM_001017525 BTB (POZ) domain containing 11 Gene [Source:MGI (curated);Acc:Btbd11-001]


Sequence tag IST12418F7HMF1
Sequence
ATTGAATTTAGGACCTCTGCTCGCTCTGGTCAACG
Sequence Type genomic DNA
Unitrap ID UNI6307 UNI14516 UNI22587

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 85005764..85005797 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020042 (Btbd11) NM_001017525 BTB (POZ) domain containing 11 Gene [Source:MGI (curated);Acc:Btbd11-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 70230148..70230181 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 41093097..41093130 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036241 (Ube2r2) NM_026275 ubiquitin-conjugating enzyme E2R 2 Gene [Source:MGI (curated);Acc:Ube2r2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 123193569..123193602 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031818 (Cox4i1) NM_009941 cytochrome c oxidase subunit IV isoform 1 Gene [Source:MGI Symbol;Acc:MGI:88473]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 120592917..120592950 34
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 12405299..12405332 34
NO GENE  

 
Come back to gene ENSMUSG00000031818


For any suggestions or comments, please send an email to unitrap@crg.es