Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10075A9
Clone ID IST10075A9
Vector VICTR75
Project tigm

Sequence tag IST10075A9BBF1
Sequence
ATGGCTATGCGCCATCAGACAGGTCAGTGGACTTAATTTATTCTAGAACTGGGGGCAGAATCACTTGTTGACTCTGTGCC
CTTCACCACTCTAGACTCTGCAGATAATGAAAGAAAGCTCTAAGGGTGGGATGCTTTAGAGACTTGCAGTTGGGCCCAAA
AGATAAACAGTTCTCTGGGCCGGATGCCCACTGTGGAACTCTCCAGTAGATACCACGGAGATTAGTGCAGCTCAGGCTGT
TAAAATACTGTACTGTGATTCGGGGAAGGGGAAGGTATTCCAGGCCATCCTACACACTTGTGAGGAGGCAAAGAATGCCT
GGGAAACTACCCTTGAAAACCTGGGAAAACTCAGGAAAGAAGAACCCAGGTAGGGTGTCAGATGATGTCAGATATTGCCC
GAAAGTGAGAAAAAGTCAAGGGACATTGCTCTGTATGTCGAATGCTTGCCTCGCAGACGAGCCATGGGGGTCATTCTTAA
ACCTAAAGAAAACCAAGTGTGGTTGCACAAGCCCAGATTCCTAGCAC
Sequence Type genomic DNA
Unitrap ID UNI13061

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84856965..84857492 516
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073633 (Fbxo36) NM_025386 F-box protein 36 Gene [Source:MGI (curated);Acc:Fbxo36-001]


Sequence tag IST10075A9BBR1
Sequence
GCCTAAGTGGAAGAAATCAAATCAAAAAAGGTCAGAGACTTTTCCATTAGACTATAGTGCTCAAAATGACAGGAAGGTTT
CTAAGTACTAGGCCTCATCAATGTGAGGACAGACATTATAGTTCGAATAATTTAACATTTTATTTATGTAGAAGATTGGT
ATTTTAAATGTATAGACAAACTTATGTTCATATATATTTAGAATTATTTAATATTAATGTATTTCTGCTTTGGGGAGCTT
TGTTTTGTTTGTGTTTTTTTTTTTTTTTTTTTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84856697..84856965 269
NO GENE  

 
Come back to gene ENSMUSG00000073633


For any suggestions or comments, please send an email to unitrap@crg.es