Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC0437
Clone ID GC0437
Cell line E14Tg2A.4
Vector pFLIP1
Project tigem
Note NULL

Sequence tag GC0437
Sequence
CTGTAAACGGATCCCACAAACTGGTATTCCCAAGTCCCAGTGTTTGACCTTTTGTGTTATCAATAATAAATTTAGCCACC
TGATCCAGAAACATGGGATTCAAATCATTTTTCTGCAAGAAGTTGTATGCAACTAGCCAGGGATCGTCACTGACATTATA
TGGTAATTTATACGATGGTCCACCTTCATTCACATCGATTGAGAAAACATAATCAAATTCTTTCCCTTCATATAAAACTT
TTCCAGATGTTTGCTGATTAGCACCAGATGAGCCAACAACATCACCAATTTTTATCCACCTCCCGTCACTAACACTCCAC
TGATAGGCTTCAACTCTCTCTCCATCTCTGATTAGACGAGTCTGTCCTTCTCTAGTACCTGGCTCACTGAGATGTTCCCT
CCCAGGAAGCTGCTCCGCATTAATATCCCCCAAGTCAACCAGTTTTGGAATCGATAGTTGCCTGAGAGAGCTCTCTCTCA
AAAG
Sequence Type mRNA
Unitrap ID UNI271

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 94249172..94250628 214
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028577 (Plaa) NM_172695 phospholipase A2, activating protein Gene [Source:MGI (curated);Acc:Plaa-001]

 
Come back to gene ENSMUSG00000028577


For any suggestions or comments, please send an email to unitrap@crg.es