Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12570D6
Clone ID IST12570D6
Vector VICTR76
Project tigm

Sequence tag IST12570D6BBF1
Sequence
ATAGGGGCAAGGTCAAACACTATCTTATTAATGCCATTTGTTCTACCAGAAAGGGCNNGATCTTTTCCAAATCANTACGG
TAATATATTTTTTCAATTATTTTTATCTTTTTAAAAAGTTATTTTTCGGTTTTACTTTTTAAATTTCATTTTCAGTATCC
ATAGGTGACCTCTTATGTGTTTCTATTCTCCAATATTACCCGAAAATTAANAATTCCATTCCTTTTTTTTTTTTTTTTTT
TTN
Sequence Type genomic DNA
Unitrap ID UNI12387

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 177053955..177054196 234
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000078869 (OTTMUSG00000016577) predicted gene, OTTMUSG00000016577 Gene [Source:MGI Symbol;Acc:MGI:3649811]

 
Come back to gene ENSMUSG00000078869


For any suggestions or comments, please send an email to unitrap@crg.es