Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AG0348
Clone ID AG0348
Vector pGT0lxr
Project sanger

Sequence tag AG0348
Sequence
TGACCAGTCAACCCATAAGTGGATGGTATATGTCCGAGGGTCGCGTAGAGAGCCCAGCATTAATCACTTTGTCAAGAAAG
TTTGGTTTTTCCTTCATCCTAGCTATAAACCAAACGATCTTGTGGAAGTTAGAGAGCCCCCCTTTCATCTGACTAGAAGA
GGCTGGGGTGAGTTTCCTGTCAGAGTGCAAGTTCACTTTAAGGACAGCCAGAACAAGCGGATAGATATCATACACAACCT
GAAGCTGGATAGAACCTACACTGGCCTACAGACCCTGGGTGCAGAGACG
Sequence Type mRNA
Unitrap ID UNI2827

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 20162079..20174612 132
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041215 (Yeats2) NM_001033237 YEATS domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:2447762]

 
Come back to gene ENSMUSG00000041215


For any suggestions or comments, please send an email to unitrap@crg.es