Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11531D6
Clone ID IST11531D6
Vector VICTR76
Project tigm

Sequence tag IST11531D6BBF1
Sequence
NGTGNNTNAANAAACAAAAACAAAAATAAAAATAAAAAAAAANCACTTATTGACTGGGGTTAAATTGANATGACGCTGAC
ACCACTCCTNCTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11531D6HMR1
Sequence
TTCTCTCTTTTTTGNCTTTTAAGAAGTTAAAGTTTTAAAATTTTACAATACCTAAACTTTTGAATTAATAACTAGTTC
Sequence Type genomic DNA
Unitrap ID UNI15390 UNI15587 UNI16988 UNI30811 UNI32321

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 11611925..11612001 75
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057715 (A830018L16Rik) NM_177173 RIKEN cDNA A830018L16 gene Gene [Source:MGI Symbol;Acc:MGI:2444149]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 23579089..23579165 75
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020010 (Vnn3) NM_011979 vanin 3 Gene [Source:MGI (curated);Acc:Vnn3-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 9873260..9873336 75
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 45815978..45816054 75
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 3199009..3199085 75
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 112767841..112767917 75
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 55705996..55706072 75
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000060429 (Sntb1) NM_016667 syntrophin, basic 1 Gene [Source:MGI (curated);Acc:Sntb1-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32509357..32509433 75
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024050 (Wiz) NM_212438 widely-interspaced zinc finger motifs Gene [Source:MGI Symbol;Acc:MGI:1332638]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 9468798..9468874 75
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 38946745..38946821 75
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048720 (Tbc1d12) NM_145952 TBC1D12: TBC1 domain family, member 12 Gene [Source:MGI Symbol;Acc:MGI:2384803]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 14269596..14269672 75
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 35315473..35315549 75
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 4166697..4166773 75
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 3254212..3254288 75
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 67888995..67889071 75
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 11550529..11550605 75
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 50436989..50437065 75
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 27140904..27140980 75
NO GENE  


Sequence tag IST11531D6HMF1
Sequence
AGTGGATTAAGAAACAAAAACAAAAATAAAAATAAAAAAAAAGCACTTATTGACTGGGGTTAAATTGAGATGACGCTGAC
ACCACTCCTACTGTGTGCTCTGGTGGGAGGGGGGGTTGGGGAGGGGTTTTCNGCCCCCNACCACCTTCCAGTTCNAGGGA
GTTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 66844994..66845156 153
NO GENE  

 
Come back to gene ENSMUSG00000048720


For any suggestions or comments, please send an email to unitrap@crg.es