Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10726F8
Clone ID IST10726F8
Vector VICTR76
Project tigm

Sequence tag IST10726F8HMF1
Sequence
CTTAACAGCTTTCACAATTCAATTTTTAAAGAAAATATGGCAGTGCATGTCAAAAAAGCAAAACTTTAGAACAAGTTTCT
TAAAAAGCCAGAGTANAAAAGATGTAAAAAAAAAAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 30910346..30910461 114
 
EST/CDNA Est Name
  AA242725.1


Sequence tag IST10726F8HMR1
Sequence
TTAAGAACACTTTAAATAGCATCCTATGTCACAGGGNCAGTTTTCCTCTGTTGCATGTAACTATTAAAACAATCCATGCT
AATGCCAGCTATGCAGTAACGTGATCTACTCTCCCTCATTGGGAGCTGCAAGGCTGGCTGTCACAAATCCCTGTGTCCCA
GGAACATCAAAACTGCANAGGCTTGTAAATTATCANTAANATTTATAACANTAAATTCNCAACCCACACAACATCCACAC
AAAGAATAGTTGATGTTGATACAAGCTGCCCACCTANATTGGACAAATTGCCCTATATTATTCTATACTCTTCTATGATA
TCCATAGCTACCTGTGGCTATTTCAAGTCACATAGATGCTGTTTGTCCNCNNCCTCCATCTTTTTCNGNCCTTNNCCCAT
CTGN
Sequence Type genomic DNA
Unitrap ID UNI5500

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 30909947..30910350 372
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048874 (Phf3) NM_001081080 PHD finger protein 3 Gene [Source:MGI Symbol;Acc:MGI:2446126]

 
Come back to gene ENSMUSG00000048874


For any suggestions or comments, please send an email to unitrap@crg.es