Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14351E12
Clone ID IST14351E12
Vector VICTR74
Project tigm

Sequence tag IST14351E12HMR1
Sequence
GACTCCCATCTCCAGTACTGTCTGTCCTCCCTTCTGANCTCCAATCTCCTGCTTCTAGTTGTCTATTCCACTTTAACACC
AAATAGGTTGATTCACTCCAAGAGATAACCACAGTCCGTGCCAGAACAATCCTTATGCCTGTCTAAAGTCACCTTGGTGC
CTCTCATAGGCCTGCATGTATCTCCTAAGAAGCCTTGCCACCTGTTTACAACACCAGACCATTTCCCAGAAACTGTAACC
TAAAGTCCCTGTCCAAGCTATCTGGTGAGCTTTTAAACTCTTCTAATTTGATCCCTACTCTTACTCTCTTNNGTTTTCTG
GACACAGAGTGATTCATTAAANTTGTAAGGTGTTATAAAAACTGANNTANTGCNNNCTTN
Sequence Type genomic DNA
Unitrap ID UNI11042

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 18287647..18288017 353
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022718 (Dgcr8) NM_033324 DiGeorge syndrome critical region gene 8 Gene [Source:MGI (curated);Acc:Dgcr8-002]


Sequence tag IST14351E12HMF1
Sequence
ATGGAAGATGTCAAAGGAAACTGATGTGAAAAGTACATAGGATCACATGGGAGGGGAATGATGACAAGAGAAGGCCAAAC
TGGGCAAACCAGTCAAAATCATGTTTCTCACAAGGTAAAATTCAGACAGCCACTGTGAACTGCCTGCTCCACATGTTTGG
CAACACAGCTCAAAGGGTAGCCCTCCTGCCTGTAAACCTCACTATTCTTCAGCTGACTGGACCTATGGATGCAGATTTTG
ATTTGCCAATTAGACTGTGAGCAAGTCAGACCCACTGCTGGCTCCCCTGGACCCTGGCACAGGGCTTACCCAAAACATGT
GAACAACTCCTACTTGCTGAACGGATGGCCAGC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 18288018..18288369 352
 
EST/CDNA Est Name
  CA539708.1 - CD551473.1 - BI794001.1 - CF579231.1 - BB855210.1 - CB244559.1 - BY033810.1 - BY299870.1 - BY346920.1 - BY070601.1 - CJ169599.1 - BY301617.1 - BY129610.1 - BY142232.1 - AW320592.1

 
Come back to gene CA539708.1 - CD551473.1 - BI794001.1 - CF579231.1 - BB855210.1 - CB244559.1 - BY033810.1 - BY299870.1 - BY346920.1 - BY070601.1 - CJ169599.1 - BY301617.1 - BY129610.1 - BY142232.1 - AW320592.1


For any suggestions or comments, please send an email to unitrap@crg.es