Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14353A11
Clone ID IST14353A11
Vector VICTR74
Project tigm

Sequence tag IST14353A11BBF1
Sequence
TTACTGACTAGGTAGTCGGTCGGCTGTTTCCAAAGTTTGCTTTTCCCANTGTGCAAGCAGCCTGTATTTTCGCTTTAATT
ACCAACANTGGTGGTGCTTGNANGTAGGGAAANATTTTATGTGANAATCNGNANGCCNNGNGTNATNATGTGACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14353A11HMR1
Sequence
CAGTAACAGTATTTTTGTGTTGGGCAAAGCAGTTTCTGAACCTTAGCATCCTCACAAGTAAAACAGGTTCANACTCACCA
GTGGTTC
Sequence Type genomic DNA
Unitrap ID UNI35307

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72886872..72886957 84
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000079469 (AC158997.2) NM_018889 GPI mannosyltransferase 3 (EC 2.4.1.-)(GPI mannosyltransferase III)(GPI-MT-III)(Phosphatidylinositol-glycan biosynthesis class B protein)(PIG-B) [Source:UniProtKB/Swiss-Prot;Acc:Q9JJQ0]

 
Come back to gene ENSMUSG00000079469


For any suggestions or comments, please send an email to unitrap@crg.es