Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12501D7
Clone ID IST12501D7
Vector VICTR76
Project tigm

Sequence tag IST12501D7BBF1
Sequence
CTAGGAGCTACATTTCCAAAACATACCTTGTTAGCCCCTTAGGTGCATCGCTCAGTGGTATTAGGCGCTCGAGCCTTGCT
GTGCATCAGTGTGCACTTTATTATCGTAAATGGATCTCTGCACCCACTCCATAATAGCTCTTCATTCCCTATCATCTTCT
TTCCCATGGCCACTTACTATAGAGGCTTCCAGATCCATTGGTGTTGCAGCATATGTCAGAATTTATTTTGTGTGTGTATG
TATGGTATGTTCCTGTGTGTATGGGGACCAGGGTAGTATAGACGTCTGTGTCTCTGTGTGTATGGGGCCAGGGTGGTATA
GATGTATGTGTTCCCCTGTGTATGGAGGCCAGGGTAGTATAGATGAATATGTTCCTGTGTGTGTGGAGGCCAGGGGTAGT
AAGAATGTATATGTTCCCATGTGTATGGAGACCAGGGGTTGATGTTTGGTGTCTTTCTCAGCTGCTCTCCACTCGACTAC
TCTCCAGCTNATTTATTCCTTTTGTTCCCCTTANTTTTGAGACACTCTCTTATTGGCTTGCCNNTTNTGCTAGAN
Sequence Type genomic DNA
Unitrap ID UNI31115

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 74367202..74367755 544
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038807 (Garnl4) NM_001015046 GTPase activating RANGAP domain-like 4 Gene [Source:MGI (curated);Acc:Garnl4-001]

 
Come back to gene ENSMUSG00000038807


For any suggestions or comments, please send an email to unitrap@crg.es