Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10551F9
Clone ID IST10551F9
Vector VICTR76
Project tigm

Sequence tag IST10551F9HMR1
Sequence
NAGCACTCGGGAGGCAGAGGCAGGTGGATTTCTGAGTTCGAGGCCAGCCTGATCTACAAACTGAGTTCCAGGACA
Sequence Type genomic DNA
Unitrap ID UNI32007

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 58158961..58159034 74
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032334 (Loxl1) NP_034859 lysyl oxidase-like 1 Gene [Source:MGI Symbol;Acc:MGI:106096]


Sequence tag IST10551F9HMF1
Sequence
CTGGGATTAAAGGCGTGCGCCACCACGCCCGGCTCTAGAAGCATTCTTAAGGCCTCTTGACCCTGAAGGTCCAAGACTCC
CATGATCCTTTGCCTCACTTTGTGCACAGGCATAGGGGAAATTTCTAAAAGTGTTAANAGATTCCCTGGGAGAGGGAGAA
GCAAGGGAGCAAGACTTTCCCCACTCGTCCCTAGATGACCCCAGCTAGATCTGCAAAGTACTTAAAACTTGGCTAGTCCT
TCCACTATTCTCCCCAAGCCAGAGTCAAAACACAGGCCTACCNNNTAGGCCTTTGACCCANNTGGATAATANTTGGATTC
NGGAGGAGAGGCACGCANGGGCTGCATGGTCCTTGTTAAGCNNCCACTGGAAGGCCTTTGATAANAAACANACNGGGTCC
GCACCAGCAATTCACCAGTGGA

Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 58159033..58159453 393
 
EST/CDNA Est Name
  BI414162.1 - BE309687.1 - BF152445.1 - AI322695.1 - BI113536.1 - AI390912.1 - AA047909.1 - BF015570.1 - AA049290.1 - AA039213.1 - CK137712.1 - BE226336.1

 
Come back to gene BI414162.1 - BE309687.1 - BF152445.1 - AI322695.1 - BI113536.1 - AI390912.1 - AA047909.1 - BF015570.1 - AA049290.1 - AA039213.1 - CK137712.1 - BE226336.1


For any suggestions or comments, please send an email to unitrap@crg.es