Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10294C5
Clone ID IST10294C5
Vector VICTR76
Project tigm

Sequence tag IST10294C5HMF2
Sequence
GTAAGTACACTGTAGCTGTCTTCANACACTCCAGAAGAGGGCGTCAGATCTTCANATGGTTGTGAGCCTTTTTTTTTTTN
AAANNTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 66452948..66453030 77
NO GENE  


Sequence tag IST10294C5BBF1
Sequence
GTAAGTACACTGTAGCTGTCTTCAGACACTCCANAAGAGGGCGTCAGATCTG
Sequence Type genomic DNA
Unitrap ID UNI10464 UNI20768 UNI31432 UNI34190

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr NT_165754: 363596..363646 49
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000072258 (Taf1a) NP_067441 TATA box binding protein (Tbp)-associated factor, RNA polymerase I, A Gene [Source:MGI Symbol;Acc:MGI:109578]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr Y: 575919..575969 49
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000068457 (Uty) NM_009484 ubiquitously transcribed tetratricopeptide repeat gene, Y chromosome Gene [Source:MGI Symbol;Acc:MGI:894810]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4709420..4709470 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 6349498..6349548 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 15077168..15077218 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 4096700..4096750 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 10409565..10409615 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 3422724..3422774 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 3544364..3544414 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4599244..4599294 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 3359220..3359270 49
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025899 (Alkbh8) NM_026303 alkB, alkylation repair homolog 8 (E. coli) Gene [Source:MGI Symbol;Acc:MGI:1914917]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 19200797..19200847 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6107956..6108006 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 3020563..3020613 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 22348013..22348063 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 3024144..3024194 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 14372447..14372497 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 3211843..3211893 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 12384021..12384071 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 9093043..9093093 49
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 5958056..5958106 49
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043241 (Upf2) NM_001081132 UPF2 regulator of nonsense transcripts homolog (yeast) Gene [Source:MGI (curated);Acc:Upf2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 9752449..9752499 49
NO GENE  

 
Come back to gene ENSMUSG00000043241


For any suggestions or comments, please send an email to unitrap@crg.es