Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST6280-NR
Clone ID PST6280-NR
Vector U3NeoSV1
Project escells

Sequence tag PST6280-NR
Sequence
AGCCTAGCCCAGAAATCTCTCTGGGAGCCCTCTTCTCCCCCCCGCCCCCCACTCCGTTCTCTTCGTGCCCCTTTCCTGCC
CTCTCTGAACCCCCCCCTAAGAAAAGGCCCTCCCCCACCTTCCCCGGAGGCCCCCTGCCTTGCGGTTCCCCTTGTATTAC
TCTTAAGCCCCCCTTTGGCCTCCCTTTTGAAAAAAACACCCCCCATTTCTNTTTCTTGGGCCTTGGTNCGGGGTTNCTAA
GCCGGGGTTTTTCCCTTGGCCTTACCCCCGAAAATCTTTGTTAGGGGGGGAAACCCTNGAAGGGGCCNGGGGGAAGGGCC
AAAGAAAAGTGGCGTCTTATTTGGGGCCCCAACGGGTTNCACCTTTTTGGTTATTTTCTTGGGGGCTTTGGGGGGCC
Sequence Type genomic DNA
Unitrap ID UNI15560

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 6283143..7315257 79
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056629 (Fkbp2) NM_008020 FK506 binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:95542]

 
Come back to gene ENSMUSG00000056629


For any suggestions or comments, please send an email to unitrap@crg.es