Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14886G6
Clone ID IST14886G6
Vector VICTR76
Project tigm

Sequence tag IST14886G6BBF1
Sequence
CAACCACATGGTAGCTTACAACCATCTGTAATGGGATCTGATGCCCTCTTCTGGTGTGTCTGAAGACAGCTACAATGTAC
TCATAAATAAATCTTTTTTAAAAAAATTAAATTGATTCTTAAAAATATTTTATTTAATTTTTATACACTATTTTTGATCA
TATTCTTTTTCCTCCCCCAACAGCAATAGAATTCTTTTCTGTATCAGTGATGACAGATATCTATCTATCTATATCTTTTT
AAAAATTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI29695

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34921813..34922068 256
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029106 (Add1) NM_013457 adducin 1 (alpha) Gene [Source:MGI (curated);Acc:Add1-002]


Sequence tag IST14886G6HMF1
Sequence
CAACCACATGGTAGCTTACAACCATCTGTAATGGGATCTGATGCCCTCTTCTGGTGTGTCTGAAGACAGCTACAATGTAC
TCATAAATAAATCTTTTTTAAAAAAATTAAATTGATTCTTAAAAATATTTTATTTAATTTTTATACACTATTTTTGATCA
TATTCTTTTTCCTCCCCCAACAGCAATAGAATTCTTTTCTGTATCAGTGATGACAGATATCTATCTATCTATATCTTTTT
AAAAATTTTTTTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI29695

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34921813..34922069 257
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029106 (Add1) NM_013457 adducin 1 (alpha) Gene [Source:MGI (curated);Acc:Add1-002]


Sequence tag IST14886G6HMR1
Sequence
GTTGCTGGGAATTGAACTCAGGACCTCTAGAAGAGTAGTCAGTGCTCTTAACTGCTGAGTNNTCCCTCCAGCCCCAATTT
AAATCCTTTTAAAAATTCCATTACCACACCAATTGGGATTTTAAAATGTGTTGGATCCGTCTAGTGTTTAGGCCCTGGAG
TCANACCGCCTGAGTTCGGATCCCAGTTCACTGATGTTTTAATTACTTTTCTATANTTGTGATCNANCNNCNCACCANGG
CNNTGTATN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000029106


For any suggestions or comments, please send an email to unitrap@crg.es