Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10377E6
Clone ID IST10377E6
Vector VICTR76
Project tigm

Sequence tag IST10377E6BBF1
Sequence
TGTGAACTTGAAGGAAGAGCAGGGAAGGGTCAGACAGCCTGCTTGAATGGGGTTGCAAATTCCTCTGCTGGCAAACTCGA
GTGCAGGGAAATGTCACCCGCTTGTTGCTTTTTATGGTCATGAAGAAGGAAAACCTCCAAGGCTTTCGATCCCTTTGCTG
GGAGTTGACCAGCTGCTTTATTTCANCCTCANATATAAAGTCGGAGCTTCAGAAGGCCCTGATTTGTTTTTGCCTTGAGT
CTGATCACCTAAAGCGTTATANTTTGATTACTAGAGAAGAAAAATAACCNTACCTTGGGAATTATAACAACCCGAACTTT
TTGGTTTCTTGAGACAGGGTTTCTCTGTATATAGCCTTANCCGTCCTGGAACATGCCCTGTANACCAGGCTGGACTCAAA
GATCTGTCG
Sequence Type genomic DNA
Unitrap ID UNI1668

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 6060197..6060604 396
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038587 (Akap12) NM_031185 A kinase (PRKA) anchor protein (gravin) 12 Gene [Source:MGI Symbol;Acc:MGI:1932576]


Sequence tag IST10377E6HMF1
Sequence
TGTGAACTTGAAGGAAGAGCAGGGAAGGGTCAGACAGCCTGCTTGAATGGGGTTGCAAATTCCTCTGCTGGCAAACTCGA
GTGCAGGGAAATGTCACCCGCTTGTTGCTTTTTATGGTCATGAAGAAGGAAAACCTCCAAGGCTTTCGATCCCTTTGCTG
GGANTTA
Sequence Type genomic DNA
Unitrap ID UNI1668

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 5168282..6060604 164
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038587 (Akap12) NM_031185 A kinase (PRKA) anchor protein (gravin) 12 Gene [Source:MGI Symbol;Acc:MGI:1932576]

 
Come back to gene ENSMUSG00000038587


For any suggestions or comments, please send an email to unitrap@crg.es