Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11324D11
Clone ID IST11324D11
Vector VICTR76
Project tigm

Sequence tag IST11324D11BBF1
Sequence
ATTTTTGTTTCTAAATAGTTTCAAAAGTATAAATATGTTTTATATGTCTTGGTTATANATTANTGGCTCATAAGTTATTG
GTTATGATTAAAAATTTGTAACATTGGTAACAAAAAGTTGACTTAAAACTGGTAACTCTGGGTTANAGTAATTTANAACT
ACAACATGCAACATGAGACAACCCATGGGAACAGGTCTCTAAAGATACNCCTGAATTGGGTAATATTCTGTGTAATTCTT
ATCCTANAAATCTGATTTATAAAANATAAGATTTAGGGTAGTGTCTTTGAGATATATTGGCGNCTACNCCTTCTTGTGTT
TGTGTGCAGGANCAGACAGCCNANCTTTGTANCAAGTAATGTTTTNAGAGTTCATTTTTAAAGAAAATANATTGTTTACA
CTGTNAAAATTGAGTTTTGCTTCTCAAAATTGTGGTTGTGCTCTCATGTTACAAGANAAATTGNANNCTTCTCCTANATT
GNANCAACCAGCTAAATCGGCTCCTCTAAANANCTATAAAGCCTCCTGANTGGCCTANTCCATANCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST11324D11HMF2
Sequence
ATTTTTGTTTCTAAATAGTTTCAAAAGTATAAATATGTTTTATATGTCTTGGTTATAGATTANTGGCTCATAAGTTATTG
GTTATGATTAAAAATTTGTAACATTGGTAACAAAAAGTTA
Sequence Type genomic DNA
Unitrap ID UNI2143 UNI30968

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 92523411..92523529 117
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 105621384..105621502 117
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 41033885..41034003 117
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 62657241..62657359 117
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074865 (6720457D02Rik) RIKEN cDNA 6720457D02 gene Gene [Source:MGI Symbol;Acc:MGI:1924367]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 22633266..22633384 117
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 18013181..18013299 117
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 40317022..40317140 117
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 9594058..9594176 117
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 22800900..22801018 117
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 150531199..150531317 117
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 21607949..21608067 117
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 66564768..66564886 117
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039005 (Tlr4) NM_021297 toll-like receptor 4 Gene [Source:MGI (curated);Acc:Tlr4-004]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 27793223..27793341 117
 
EST/CDNA Est Name
  BG971329.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 62187937..62188055 117
NO GENE  

 
Come back to gene BG971329.1


For any suggestions or comments, please send an email to unitrap@crg.es