Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AG0310
Clone ID AG0310
Vector pGT0lxr
Project sanger

Sequence tag AG0310
Sequence
TTGAACGTTTATGGCATCGATTCCTCGAACACTAACACTCACGGCGCGAAGGAGAGAAACAGGAAGTTGAAGAAGCATTG
GAGCCTGTATCACCCTCACTCAAGAGCAGACGCCAACGGCTGGGCATCAGAAAGGCCCAGAGAGTTGAAAGTGCCAAAGG
GAGTGGAGTGTAAGGGGGACGCTGAGAGCGTGCAGAGGAGCAGGCTTGGGAATCCAGACCTGTCTGCCACCGATGGTTTG
CCTGATTTCTCAGGCTCTGCAATTTCAGTCATCAGAAAACAGCAAAAAAACGTGCTTGCTCAGCCAGCTGAGGAAGAAAA
TTTGTATTTTGAAGATGCCTTTTCTCTCATAGACTTTTTACCTGTTGATGCCATCGAACCTACTTCATCACAGGTGCAGA
ACACAGAAAAGTCTGGACTGAGAAAAGAGAGAAGAAATACGGCATCCAAGGCAAGGGACTCAAGCATATATTCACCACTA
ACCTCTTTCATCACTGCTGATTCACAATTGCATGACATTATTGAAGATCTGGAG
Sequence Type mRNA
Unitrap ID UNI2837

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 105263054..105263587 532
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036009 (BC067068) NM_207522 Uncharacterized protein C12orf26 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q6NXH8]

 
Come back to gene ENSMUSG00000036009


For any suggestions or comments, please send an email to unitrap@crg.es