Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12511B10
Clone ID IST12511B10
Vector VICTR76
Project tigm

Sequence tag IST12511B10BBF1
Sequence
AGGCTAAGGCAGTGAAGACCACTGGAGTGCAGGCCACAGTGGCGGAGGTCATAGGAGTGAAGGTCACAGGAGTGCAGACC
ACAGCGATAGAAGCTATAGGAGTCAAGGACACCACCCAGGTGGCCACAGGAGCGCAGGCCGATTGCTGGCAGGCCACGGA
GGCAGACTGCACCGGAGCGCAGGACACAGCTATGGAGCCCACGGGGGCACAGGCCACTGTGACAGAGACTACGGANNNNN
AGACCAGCGGCACGGAGGACCCTTGNNNNGCGATCCTGCACCCGGNNNNNNCGGCGGCGGCGCTGCAGGCCGAGCTGGAG
ACCCGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12511B10HMF1
Sequence
AGGCTAAGGCAGTGAAGACCNCTGGAGTGCAGGCCACAGTGGCGGAGGTCATAGGAGTGAAGGTCACAGGAGTGCAGACC
ACAGCGATAGAAGCTATAGGAGTCAAGGACACCACCCAGGTGGA
Sequence Type genomic DNA
Unitrap ID UNI30832

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 81105905..81106027 121
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054708 (Ankrd24) NM_027480 ankyrin repeat domain 24 Gene [Source:MGI (curated);Acc:Ankrd24-001]

 
Come back to gene ENSMUSG00000054708


For any suggestions or comments, please send an email to unitrap@crg.es