Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST6056-NR
Clone ID PST6056-NR
Vector U3NeoSV1
Project escells

Sequence tag PST6056-NR
Sequence
ACACAAAGCTGTCAATCAGCACGGTGGAGCGTGTCCTGGAGTGGGAGAGCTCATAAAAATAGCATATTAATCCCCACCAG
CCAACTAACGTAGAAGAACCGATGAGCGTGGACAGGGCCGTGGGTCTCAAGCTGAACCAATGTGGAGGGAGTGTTGGAGG
CACTAGGCCAAGAACCTAGTCTGGCCGGGCCACAATTCAAACCTTTATCTGATTCCTTCTTCTTT
Sequence Type genomic DNA
Unitrap ID UNI15563

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 33739250..33739467 193
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024300 (Myo1f) NM_053214 myosin IF Gene [Source:MGI Symbol;Acc:MGI:107711]

 
Come back to gene ENSMUSG00000024300


For any suggestions or comments, please send an email to unitrap@crg.es