Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13117H3
Clone ID IST13117H3
Vector VICTR76
Project tigm

Sequence tag IST13117H3BBF1
Sequence
NTGCATACTTGCAATCCCAGCAGTTGGGAAGTGGAGGCAGGGGGTGAGGTGTTCAGGCCGGCTACATTTAAGCTACACAG
CAAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 36082194..36082281 88
NO GENE  


Sequence tag IST13117H3HMF1
Sequence
GGCAATGCATGCACGCTCGTGTTCTTACCTAAAAGGAGTGTAAGAAAGCTGGGTGGGGGAGACACAAGCCTTTTACCCCA
TCACGTGGGAGGCAGAGGCAGGTGGATCTCTCTGAGATTAAGGCCAGCCAGGTTCACAGTGTGTTCCAAGGAGCAGCATA
GTGGGACCCTGCCTCAAAAAAACAAAAACAAAACAAAACCAAAAACCAAAAACCAAAAACAAAACCAAAATGTAATCAGG
TCTGGATTAAGTCCGAACGCTCCCCACATCTGGGTTCTGTGTATGCCCTCCACCAGTGTTAACG
Sequence Type genomic DNA
Unitrap ID UNI11370

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 101212074..101212376 303
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042035 (Igsf3) NM_207205 immunoglobulin superfamily, member 3 Gene [Source:MGI Symbol;Acc:MGI:1926158]

 
Come back to gene ENSMUSG00000042035


For any suggestions or comments, please send an email to unitrap@crg.es