Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15031B11
Clone ID IST15031B11
Vector VICTR78
Project tigm

Sequence tag IST15031B11BBF1
Sequence
GGTAGAAGGAGAGAATCGATTCCTCTGTGTTGTCCTCTGAGCTCCTCAACCACACAAAAATGAATAAATAACCACAGGTG
CTGCCTCTCCACTGTTCCACCTCCATGCTCTCTACTCTGAATTCATCACATGCAAATAGCATCAATTATTGCTATTTATC
CTGTGTGTATAGGCATACAAGGAAGTGTGCTTGTCTAGAAAGTTTGAGAGCCTGGGTTTAATCCCTAGCATCACAGAAAC
AAAGCAAACAACAACAACAACAACAACAACAACAACNAAGCATTTGCTTCCAGTATTATATATTGACTTTCTCCTTTTAG
TGGACTTTTANGTCCTTCCCCATCTTTTTACTANTNNTATGCTTTGCTTANAAN
Sequence Type genomic DNA
Unitrap ID UNI13416

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 78795267..78795639 361
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001123 (Lgals9) NM_010708 lectin, galactose binding, soluble 9 Gene [Source:MGI (curated);Acc:Lgals9-001]

 
Come back to gene ENSMUSG00000001123


For any suggestions or comments, please send an email to unitrap@crg.es